PROVIDE SOURCES, OR BE LABELLED A SHIT-TALKER.Silent Song said:
Don't evade questions by appealing to a phantom science-literate crowd that doesn't exist. Back up your comments, or don't bother making them.
Low Biological Quality of Humankind
- Thread starter infoterror
- Start date
Don't evade questions by appealing to a phantom science-literate crowd that doesn't exist. Back up your comments, or don't bother making them.
Silver Incubus
Dead Hands Justin
Try Charles Darwin, "On the Origin of Species by Means of Natural Selection, or the Preservation of Favoured Races in the Struggle for Life" 1859
Read online!
http://etext.lib.virginia.edu/toc/modeng/public/DarOrig.html
Read online!
http://etext.lib.virginia.edu/toc/modeng/public/DarOrig.html
Silent Song said:
This is a grossly oversimplified notion. I think that in a few dozen years we will be able to engineer better genes than mutation would come up with in millions of years. Since there is no natural selection (in the civilized world), there is no need for genes to improve.
Kenneth R.
Cináed
and what would that engineering be if not an artificial mutation?
Inchoate would you like me to provide sources detailing why the sky is blue? seriously.
Inchoate would you like me to provide sources detailing why the sky is blue? seriously.
No, I already know why that is.
If you are going to make claims about evolutions, genomes, and biological diversification, you need to provide sources, otherwise they are opinions, opinions that don't count in a debate where sources are required to back up claims such as what you make.
If you are going to make claims about evolutions, genomes, and biological diversification, you need to provide sources, otherwise they are opinions, opinions that don't count in a debate where sources are required to back up claims such as what you make.
Kenneth R.
Cináed
ah, you're the sources type. debate concerns ideas. when ideas require further confirmation to be understood or agreed upon/discussed, then sources should come into play. however, when having a conversation such as "how are you today" you do not answer with medical records and detailed psycho-analysis.
so i take it you are either not familiar with, or skeptical of evolution/mutation then?
i am a Christian, i do not believe in macro-evolution from microbe-to-man, but changes on a small scale are evident to me, and responsible for our adaptation to our environmental changes so that we might survive better.
so i take it you are either not familiar with, or skeptical of evolution/mutation then?
i am a Christian, i do not believe in macro-evolution from microbe-to-man, but changes on a small scale are evident to me, and responsible for our adaptation to our environmental changes so that we might survive better.
NeverIsForever
Member
SS, this is one of those rare occasions where we are not in complete agreement :Spin:
True, genetic mutation CAN allow genetic improvement. In an environment free of artificial interference, those individuals with mutations best suited to what the environment has to offer will be most successful. ("Successful" in the Darwinian sense, ie they survive to pass on their genetic material to more offspring than their competitors lacking in the useful mutations.)
However, advanced medical care and technology among humans today allows individuals with almost ALL mutations, whether beneficial or detrimental, to survive. We don't adapt to suit our environment--we adapt it to suit us. Thus individuals with poor eyesight, mental defects, congenital heart problems, you name it--are every bit as successful as individuals without such problems. Our humanity makes natural selection impossible--we cannot, or will not, stand by and let nature take its course. I'm not saying this is a bad thing, but I am saying it has resulted in the deterioration of our gene pool.
True, genetic mutation CAN allow genetic improvement. In an environment free of artificial interference, those individuals with mutations best suited to what the environment has to offer will be most successful. ("Successful" in the Darwinian sense, ie they survive to pass on their genetic material to more offspring than their competitors lacking in the useful mutations.)
However, advanced medical care and technology among humans today allows individuals with almost ALL mutations, whether beneficial or detrimental, to survive. We don't adapt to suit our environment--we adapt it to suit us. Thus individuals with poor eyesight, mental defects, congenital heart problems, you name it--are every bit as successful as individuals without such problems. Our humanity makes natural selection impossible--we cannot, or will not, stand by and let nature take its course. I'm not saying this is a bad thing, but I am saying it has resulted in the deterioration of our gene pool.
The_Isle
Member
We already have. By conquering it we've made it adapt to us. I guess that's a sort of meta-adaption.
Kenneth R.
Cináed
Silent Song said:
No - it's through SELECTION OF certain mutations and rejections of the rest that our genetic data improves.
Kenneth R.
Cináed
NeverIsForever
Member
Absolutely, though human interference prevents this. We are too soft-hearted to stand aside and let nature take its course.
I wonder if humans will ever experience any further (substantial) evolutionary change?The circumstances to catalyze structural changes in our phenotypes don't really exist anywhere, as we more or less force our environment to suit our needs rather than it forcing us...
Makes me wish I could see the way things are a hundred, or two hundred, or a thousand years from now...
I wonder if humans will ever experience any further (substantial) evolutionary change?The circumstances to catalyze structural changes in our phenotypes don't really exist anywhere, as we more or less force our environment to suit our needs rather than it forcing us...
Makes me wish I could see the way things are a hundred, or two hundred, or a thousand years from now...
Kenneth R.
Cináed
at some point our ability to form the environment to suit us will be exhausted, as we pile ever more grains of sand into our palms, there will come a time when it runs through our fingers... i do not suggest we kill each other to speed this process, nor do i support the enfeeblement of man due to dependence on technology and unnecessary medicine..
The_Isle
Member
infoterror said:
genes don't improve. They adapt.
Behold the cockroach. Ever since it evolved into its current form several million years ago it has had basically no need for much genetic change. It's become perfectly adapted to survival and propagation. That's the real goal of genes.
Do you even know what a gene is? I bet you don't. It's pretty simple, really - a gene is a sequence of DNA that codes for a protein. Here's a hypothetical example: AGTTTCGATAACGATGCTGATGCTGCCA (they'd have to be in codons - sets of 3 - that that's beside the point). Let's say this codes for a patch of nervous tissue sensitive to the amount of light. Let's also say that a mutation occurs, in which, instead of simply being sensitive to the amount of light, the patch of nerves is now able to make out distinct wavelengths of light. Does this mean that the gene has adapted (to its environment)? Of course not : a gene is not a living organism, but a chain of chemicals, and it can improve with respect to the organism which carries it. If the mutation improves an organism's ability to survive, the organism has now adapted to its environment.
Silent Song said:
Depends on what needs to be selected. If we murder all the morons and perverts and criminals, and let the rest sort it out, nature will be doing most of the selecting
Of course, for natural selection to exist, we'd have to give up these cities, this climate control, buying food, etc. so consider the implications of what you're saying.
Kenneth R.
Cináed
i know full well what i'm saying. i think we rely too much on technology to solve our problems for us.infoterror said:Depends on what needs to be selected. If we murder all the morons and perverts and criminals, and let the rest sort it out, nature will be doing most of the selecting
Of course, for natural selection to exist, we'd have to give up these cities, this climate control, buying food, etc. so consider the implications of what you're saying.
you're saying "murder" all the "criminals". that seems contradictory to me. would you then commit suicide afterwards, to kill yourself for your own crime of murder? it makes no sense to do this. besides, criminal action is not genetic, it is incited by environmental conditions and experiences. if you kill every killer, more will take their places until there is no one left to kill.
I hope you cheered to let Schiavo die, in that case, Silent Song - nature was calling, and she should have been dead a long time ago. Should we get rid of flu vaccines as well? Those certainly are not natural. Neither is biotechnology! Nor cell phones! Nor the computer that you're using. Throwing out pointless and general statements like "we rely too much on technology" like a gutless "yes"-man is lame.
Kenneth R.
Cináed
i happen to hate cellphones.
keep in mind i am not arguing to abolish what we have learned, but what meager use we put it to. medicine can save lives, but it is not as necessary on a daily basis as some people would think. such as taking painkillers every time you have a headache, or a cough, or a cold. i'm arguing to do away with unnecessary medicine and technology. that which exists just for its own sake, to be "newer" without being "better".
keep in mind i am not arguing to abolish what we have learned, but what meager use we put it to. medicine can save lives, but it is not as necessary on a daily basis as some people would think. such as taking painkillers every time you have a headache, or a cough, or a cold. i'm arguing to do away with unnecessary medicine and technology. that which exists just for its own sake, to be "newer" without being "better".
Similar threads
